Gene Information: F53C11.9

NameF53C11.9 View on WormBase
Species C. elegans
SequenceF53C11.9
Genetic positionV:5.59 +/- 0.000 cM
Genomic positionV: 13778015..13778592

Strains carrying this gene

Strain Genotype Description
RG3031 F53C11.9(ve531[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.