Gene Information: F11A5.3
| Name | F11A5.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Updating |
| Genetic Position | Updating |
| Genomic position | Updating |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3714 | F11A5.3(gk3668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 370 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTGTGTGTATGTATGTAGATCAGTGTTCC; Right flanking sequence: CGGAAAGTCTAATCTATTGCTGCGATTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |