Gene Information: T12A7.2
| Name | T12A7.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T12A7.2 |
| Genetic position | IV:5.28 +/- 0.000 cM |
| Genomic position | IV: 11756376..11761111 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3043 | T12A7.2(ve543[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2862 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tttttgtaagtaaatttgaaatacccggta ; Right flanking sequence: tgaggaaaagaaatattgattaggcgtatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |