Gene Information: vamp-8
| Name | vamp-8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | B0513.9 |
| Genetic position | IV:10.89 +/- 0.000 cM |
| Genomic position | IV: 13860367..13865196 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3892 | vamp-8(gk3845[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1092 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAGTTCCTATTTCAAACAAAAAAACTCCA; Right flanking sequence: GGGCTTGTTGCTGTCGTTTTCCATTGACTG. See WormBase Variation gk3845 for details. |