Gene Information: C33G8.2
| Name | C33G8.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C33G8.2 |
| Genetic position | V:0.50 +/- 0.000 cM |
| Genomic position | V: 7009761..7012311 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4441 | C33G8.2(gk5516[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 3868 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTGACGCTCAAGAAATCATGGACCTTGA; Right flanking sequence: CGTGGCCAATCCTCAAAATGCCCTACGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |