Gene Information: ZK185.3
| Name | ZK185.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | ZK185.3 |
| Genetic position | IV:0.45 +/- 0.000 cM |
| Genomic position | IV: 4528759..4530432 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4357 | ZK185.3(gk5440[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2074 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTTTCTCCGTGTACCTCTTTGTACCAATG; Right flanking sequence: GGCGGCTGAATGCGATCTTTTCCAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |