Gene Information: ZK185.3

NameZK185.3 View on WormBase
Species C. elegans
SequenceZK185.3
Genetic positionIV:0.45 +/- 0.000 cM
Genomic positionIV: 4528759..4530432

Strains carrying this gene

Strain Genotype Description
VC4357 ZK185.3(gk5440[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 2074 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTTTCTCCGTGTACCTCTTTGTACCAATG; Right flanking sequence: GGCGGCTGAATGCGATCTTTTCCAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.