Gene Information: T21B4.3
| Name | T21B4.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T21B4.3 |
| Genetic position | II:10.15 +/- 0.000 cM |
| Genomic position | II: 12495487..12497081 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4354 | T21B4.3(gk5437[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGACATAGGATTTCATCGATCACAAGACCG; Right flanking sequence: GGGAGTGTAGAAGTGAAGTCAATTGATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |