Gene Information: F42F12.3
| Name | F42F12.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F42F12.3 |
| Genetic position | X:7.03 +/- 0.000 cM |
| Genomic position | X: 12350578..12351788 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4215 | F42F12.3(gk5201[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 1066 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGTTTTGATTTTAAAGGTATTCCGATG ; Right flanking sequence: ATCGGCATCTAATTTCTAATGCTTCAAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |