Gene Information: C32D5.6
| Name | C32D5.6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C32D5.6 |
| Genetic position | II:-0.38 +/- 0.000 cM |
| Genomic position | II: 6331820..6333987 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4307 | C32D5.6(gk5390[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1833 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTACATCATCGGTGTTCGACATCCCATTG; Right flanking sequence: AAATTTGAAAAAAAAAACTACAATGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |