Gene Information: F28C6.5
| Name | F28C6.5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F28C6.5 |
| Genetic position | II:0.82 +/- 0.000 cM |
| Genomic position | II: 8599514..8600530 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4252 | F28C6.5(gk5336[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 716 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATTGTTTTTGTTGATTGTGACATCGGA; Right flanking sequence: CGCTCAGTAATAATCGATGAAGCGAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |