Gene Information: K08E4.8
| Name | K08E4.8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K08E4.8 |
| Genetic position | IV:5.60 +/- 0.000 cM |
| Genomic position | IV: 12060397..12061329 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4234 | K08E4.8(gk5320[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCGAAAATGGGATATACTTTTGTCCAGCA; Right flanking sequence: GCTGGAAAAAATTTGGACCATTTTAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |