Gene Information: eef-1A.2
| Name | eef-1A.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | R03G5.1 |
| Genetic position | X:-1.12 +/- 0.000 cM |
| Genomic position | X: 7823654..7825769 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4096 | eef-1A.2(gk5157[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 1624 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAGCCTAAAACATATTTAAGCCTCCC ; Right flanking sequence: GATCATCCGGAAAGGTCACCAAGTCCGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |