Gene Information: ptr-19
| Name | ptr-19 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y39A1B.2 |
| Genetic position | III:5.38 +/- 0.006 cM |
| Genomic position | III: 10781853..10791176 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4203 | ptr-19(gk5288[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 4684 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGTGATCATCGAAGATAGAATATTGGGGA; Right flanking sequence: TAGTGATATTGGTAGACGAGGTCCTTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |