Gene Information: F21D5.9

NameF21D5.9 View on WormBase
Species C. elegans
SequenceF21D5.9
Genetic positionIV:3.96 +/- 0.000 cM
Genomic positionIV: 8724020..8724876

Strains carrying this gene

Strain Genotype Description
VC4045 F21D5.9(gk5119[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 731 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATCGTCTTCAATCAGATTGATGTCAACA ; Right flanking sequence: CTTGGTTCTGGAATCCAATTTTCTTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.