Gene Information: F21D5.9
Name | F21D5.9 View on WormBase |
---|---|
Species | C. elegans |
Sequence | F21D5.9 |
Genetic position | IV:3.96 +/- 0.000 cM |
Genomic position | IV: 8724020..8724876 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4045 | F21D5.9(gk5119[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 731 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATCGTCTTCAATCAGATTGATGTCAACA ; Right flanking sequence: CTTGGTTCTGGAATCCAATTTTCTTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |