Gene Information: C10C5.3
| Name | C10C5.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C10C5.3 |
| Genetic position | IV:4.19 +/- 0.000 cM |
| Genomic position | IV: 9374829..9376492 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4038 | C10C5.3(gk5112[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATACGGTAAGTAATGTCTTATGCCTGCG ; Right flanking sequence: CCAGGTATTGAAATCTACCAAACGCTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |