Gene Information: ZK185.5
| Name | ZK185.5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | ZK185.5 |
| Genetic position | IV:0.46 +/- 0.000 cM |
| Genomic position | IV: 4541693..4545918 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3979 | ZK185.5(gk5056[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 4521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGTTTACTTTTCTTGGTTTAATCACTTT; Right flanking sequence: CGCCTGATAATCTTCTAAAACTTTGAACAG. See WormBase Variation gk5056 for details. |