Gene Information: F54D1.1

NameF54D1.1 View on WormBase
Species C. elegans
SequenceF54D1.1
Genetic positionIV:4.93 +/- 0.000 cM
Genomic positionIV: 11261835..11263075

Strains carrying this gene

Strain Genotype Description
VC4003 F54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details.