Gene Information: F54D1.1
Name | F54D1.1 View on WormBase |
---|---|
Species | C. elegans |
Sequence | F54D1.1 |
Genetic position | IV:4.93 +/- 0.000 cM |
Genomic position | IV: 11261835..11263075 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4003 | F54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details. |