Gene Information: K07H8.9
| Name | K07H8.9 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K07H8.9 |
| Genetic position | IV:3.70 +/- 0.000 cM |
| Genomic position | IV: 8285175..8286476 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3962 | K07H8.9(gk5040[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAAACAAAGATAATGATGAGCACCGGGAA; Right flanking sequence: GTCGGATAGCTGCAAAAAAACAGATAACTG. See WormBase Variation gk5040 for details. |