Gene Information: C26D10.3

NameC26D10.3 View on WormBase
Species C. elegans
SequenceC26D10.3
Genetic positionII:0.76 +/- 0.000 cM
Genomic positionII: 8325386..8329654

Strains carrying this gene

Strain Genotype Description
RG3038 C26D10.3(ve538[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1301 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tctcgagtaattcgtatcctgcgaataaat ; Right flanking sequence: CAAGGAGAAGTGTGTGGAAGAGCGATGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.