Gene Information: F15D4.2
| Name | F15D4.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F15D4.2 |
| Genetic position | II:15.98 +/- 0.000 cM |
| Genomic position | II: 13216092..13216764 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3946 | F15D4.2(gk5020[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 449 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGTGGGAAGCTGTCGAGGTGCTGATGCCA; Right flanking sequence: TGGAAGAGGATCTTGAAGATTTTCTCTAAA. See WormBase Variation gk5020 for details. |