Gene Information: B0205.12
| Name | B0205.12 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | B0205.12 |
| Genetic position | I:5.06 +/- 0.000 cM |
| Genomic position | I: 10730463..10730743 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3937 | B0205.12(gk5015[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTAAAATATGGGTCTCTTCTCGCATCTCCT; Right flanking sequence: TGGAAGACTATCTGAAGCAATACAAAAAGG. See WormBase Variation gk5015 for details. |