Gene Information: EEED8.4
| Name | EEED8.4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | EEED8.4 |
| Genetic position | II:-1.69 +/- 0.000 cM |
| Genomic position | II: 5409319..5411235 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3810 | EEED8.4(gk3778[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 331 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATCATTTAGTATTCTATGAGTTGGTCCTC; Right flanking sequence: AGGATGTGGACAGATTGTGAAAACTACAAT. See WormBase Variation gk3778 for details. |