Gene Information: F23D12.1

NameF23D12.1 View on WormBase
Species C. elegans
SequenceF23D12.1
Genetic positionX:16.70 +/- 0.000 cM
Genomic positionX: 14425290..14428152

Strains carrying this gene

Strain Genotype Description
VC4452 F23D12.1(gk5527[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Homozygous viable. Deletion of 3203 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTGGCAAAGTACAAGTAACATGCTCACCG; Right flanking sequence: AAAAATACCTCATATGATGATACAGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.