Gene Information: T13C2.2
| Name | T13C2.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T13C2.2 |
| Genetic position | II:0.11 +/- 0.000 cM |
| Genomic position | II: 6792191..6799317 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4437 | T13C2.2(gk5512[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1335 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCCGTTGCGAAAGCGCTTCATACAGTCCA; Right flanking sequence: TTTGGATTTTCTAGCAGGCCCCGTAGTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |