Gene Information: C32F10.4
| Name | C32F10.4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C32F10.4 |
| Genetic position | I:0.46 +/- 0.000 cM |
| Genomic position | I: 5808421..5810002 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4438 | C32F10.4(gk5513[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 1557 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCACTTCGGACTGTTATATGTCCTGGTTCA; Right flanking sequence: GACATCGACCATATCAGTCGTATGTCACCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |