Gene Information: C13F10.7
| Name | C13F10.7 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C13F10.7 |
| Genetic position | V:0.64 +/- 0.000 cM |
| Genomic position | V: 7222054..7223252 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4408 | C13F10.7(gk5486[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGAGAAAATATTAATGTGGAGGTGGTTACT; Right flanking sequence: GATGGGTTTTATAGAAAAATTATCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |