Gene Information: Y48E1C.2
| Name | Y48E1C.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y48E1C.2 |
| Genetic position | II:16.96 +/- 0.000 cM |
| Genomic position | II: 13424542..13428974 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4360 | Y48E1C.2(gk5443[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 4099 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTAAATTTTCAGATGGAAGAGCAGGAGCC; Right flanking sequence: GCCATCTACTCGACCCTCGAACCCGGCGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |