Gene Information: F59E12.1
| Name | F59E12.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F59E12.1 |
| Genetic position | II:-0.98 +/- 0.000 cM |
| Genomic position | II: 5654515..5657371 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4273 | F59E12.1(gk5356[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1652 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTCTTGTTCTTCCTCCAACCAAGCCTCCC; Right flanking sequence: TTGGGTGAAGCAACATACGATCAAGGAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |