Gene Information: E04F6.15
| Name | E04F6.15 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | E04F6.15 |
| Genetic position | II:0.50 +/- 0.000 cM |
| Genomic position | II: 7208663..7210287 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4244 | E04F6.15(gk5328[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1646 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCAGGTACCAATTTTTTGGAACCCGAAA; Right flanking sequence: ACCATCAGCAACCATTCTGAAAATGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |