Gene Information: F07H5.13
Name | F07H5.13 View on WormBase |
---|---|
Species | C. elegans |
Sequence | F07H5.13 |
Genetic position | II:0.90 +/- 0.000 cM |
Genomic position | II: 8790557..8791441 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4240 | F07H5.13(gk5324[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTAAATTCATAATTTTCAGATGTAAATCCA; Right flanking sequence: TTTTATGCATTCTCTCTCTTCCTTCTTCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |