Gene Information: EEED8.12
| Name | EEED8.12 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | EEED8.12 |
| Genetic position | II:-1.69 +/- 0.000 cM |
| Genomic position | II: 5408260..5409024 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3763 | EEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |