Gene Information: C28H8.2
| Name | C28H8.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C28H8.2 |
| Genetic position | III:-1.43 +/- 0.000 cM |
| Genomic position | III: 5920322..5924507 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4500 | C28H8.2(gk5571[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 1038 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGCCAAGCCCTCATTTTGTGCTATTTGAAA; Right flanking sequence: TATGGCCTTCAATTGCTGAATAGAGATTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |