Gene Information: C28C12.4
Name | C28C12.4 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C28C12.4 |
Genetic position | IV:3.85 +/- 0.000 cM |
Genomic position | IV: 8487483..8488490 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4493 | C28C12.4(gk5565[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGGATGAGAGAGTGAGAGAGAGTAGGTAT; Right flanking sequence: AGCATGAACGAGTCTTCTGATGTCAACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |