Gene Information: C49A9.10
Name | C49A9.10 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C49A9.10 |
Genetic position | IV:3.09 +/- 0.000 cM |
Genomic position | IV: 6205784..6206344 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC3961 | C49A9.10(gk5039[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGCTTTTTTCTTGTTCCAAGTGCCG; Right flanking sequence: CACCGTGCTGGTTCTCGGCCATTTGGTGGG. See WormBase Variation gk5039 for details. |