Gene Information: C49A9.10

NameC49A9.10 View on WormBase
Species C. elegans
SequenceC49A9.10
Genetic positionIV:3.09 +/- 0.000 cM
Genomic positionIV: 6205784..6206344

Strains carrying this gene

Strain Genotype Description
VC3961 C49A9.10(gk5039[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGCTTTTTTCTTGTTCCAAGTGCCG; Right flanking sequence: CACCGTGCTGGTTCTCGGCCATTTGGTGGG. See WormBase Variation gk5039 for details.