Gene Information: C16C8.20
| Name | C16C8.20 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C16C8.20 |
| Genetic position | II:-6.30 +/- 0.000 cM |
| Genomic position | II: 3446947..3448168 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4419 | C16C8.20(gk5497[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTAGAGAGTTTTTTCTCGAATTTACCT; Right flanking sequence: CGGCAGTTTGCGAATAAATAATTGTGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |