Gene Information: B0244.5
| Name | B0244.5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | B0244.5 |
| Genetic position | III:-1.45 +/- 0.000 cM |
| Genomic position | III: 5744879..5747195 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4423 | B0244.5(gk5501[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 2573 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAGCGTATGAACTGCTGGTAGGGGTTTTA; Right flanking sequence: TGGCCATATTTTTCCTGCAGTGCCGCACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |