Gene Information: tric-1B.1
| Name | tric-1B.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y57A10A.10 |
| Genetic position | II:7.44 +/- 0.000 cM |
| Genomic position | II: 12256852..12266245 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4329 | tric-1B.1(gk5412[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 3742 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGGTAAGTAATTTCAAACGGTGAGATTATT; Right flanking sequence: GTCGGTCATTGGAACTCCACGAGGTCTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |