Gene Information: K03H1.13
| Name | K03H1.13 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K03H1.13 |
| Genetic position | III:1.32 +/- 0.000 cM |
| Genomic position | III: 9947745..9950344 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4189 | K03H1.13(gk5275[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 1796 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGAAAACACGATATTTGATTTGAAAGCA ; Right flanking sequence: GATTCATCCGTTACAACTTCTATAGATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |