Gene Information: Y57G11A.5
| Name | Y57G11A.5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y57G11A.5 |
| Genetic position | IV:12.19 +/- 0.000 cM |
| Genomic position | IV: 14511884..14512505 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3940 | Y57G11A.5(gk5018[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCAGTTTTTACACTTTTAAATATGTTA; Right flanking sequence: GGGTACTTGGTTGTCAGAGCTATTGCTTTT. See WormBase Variation gk5018 for details. |