Gene Information: C18D11.10
| Name | C18D11.10 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C18D11.10 |
| Genetic position | III:13.25 +/- 0.000 cM |
| Genomic position | III: 11807718..11808479 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4310 | C18D11.10(gk5393[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 1832 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATAACCCGAAGAGGAGATGCGAGAACGATG; Right flanking sequence: CTAGGTGTCAATGTGAAATGTTTTTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |