Gene Information: Y69A2AR.32
| Name | Y69A2AR.32 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y69A2AR.32 |
| Genetic position | IV:-7.06 +/- 0.000 cM |
| Genomic position | IV: 2610436..2612441 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3967 | Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details. |