Gene Information: bgnt-1.1
| Name | bgnt-1.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F01D4.9 |
| Genetic position | IV:4.60 +/- 0.000 cM |
| Genomic position | IV: 10472778..10478252 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| FX19119 | atm-1(tm5027) C46H11.6(tm7811) I; tmIn20 II; xpc-1(tm3886) F01D4.9(tm7812) IV; aqp-4(tm7813) V. | tmIn20 is an inversion between F46C5.9 and C08H9.13 in LG II. Inversion strain obtained by Next-generation sequencing. |
| VC3671 | bgnt-1.1(gk3637[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTGTTCTGTGTTTGCTACCCGGTTAAA; Right flanking sequence: AAACAAGTCAAAAGAACAATTTGTCAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |