Gene Information: Y55F3BR.1

NameY55F3BR.1 View on WormBase
Species C. elegans
SequenceY55F3BR.1
Genetic positionIV:-23.20 +/- 0.000 cM
Genomic positionIV: 874791..881910

Strains carrying this gene

Strain Genotype Description
VC4369 Y55F3BR.1(gk5450[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8878 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTGTATTTCAGTCCCGAATCCTGCAAAAA; Right flanking sequence: CACTATTTTCTTATCAAATTCCGTGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.