Caenorhabditis Genetics Center (CGC)

Gene Information: ilys-4

Nameilys-4 View on WormBase
Species C. elegans
SequenceC55F2.2
Genetic positionIV:3.50 +/- 0.000 cM
Genomic positionIV: 7895628..7897543

Strains carrying this gene

Strain Genotype Description
PHX700 ilys-4(syb700) IV. Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).
VC3885 ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.