Gene Information: Y37F4.6

NameY37F4.6 View on WormBase
Species C. elegans
SequenceY37F4.6
Genetic positionI:5.44 +/- 0.000 cM
Genomic positionI: 10869956..10875050

Strains carrying this gene

Strain Genotype Description
VC2342 Y37F4.6(gk1166) I. Y37F4.6. External left primer: CAGAAGTTTGTGGGTTCGGT. External right primer: ACCTGCCTACGTGCCTAGAA. Internal left primer: ACTCCATATCTCCGCAGGAA. Internal right primer: TCCTGGTCCATCTTCGAGTT. Internal WT amplicon: 2083 bp. Deletion size: 990 bp. Deletion left flank: TGAACACTTTTTTGTAAAAAATTTGGTTGC. Deletion right flank: CACGAGGGGCGTGGCCAACGACAATGATTG. Insertion Sequence: CGAGTTGGAACCAATTGATTTGAGCTTCATTATTTTTGAATATTCTAAATAGTTAAAGG TCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2690 Y37F4.6(gk1113) I. Y37F4.6. External left primer: GCGGGACTGTGTTTCAATTT. External right primer: CAGAAGTTTGTGGGTTCGGT. Internal left primer: CTCAGCAAAGGCCAATCTTC. Internal right primer: ACTCCATATCTCCGCAGGAA. Internal WT amplicon: 1919 bp. Deletion size: 882 bp. Deletion left flank: AGCAAACTGAATATTACAAAGCCCGCATTT. Deletion right flank: AAACTTGTTAAACACAATGTGATCTAAAAC. Insertion Sequence: AAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807