Gene Information: Y37F4.6
Name | Y37F4.6 View on WormBase |
---|---|
Species | C. elegans |
Sequence | Y37F4.6 |
Genetic position | I:5.44 +/- 0.000 cM |
Genomic position | I: 10869956..10875050 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC2342 | Y37F4.6(gk1166) I. | Y37F4.6. External left primer: CAGAAGTTTGTGGGTTCGGT. External right primer: ACCTGCCTACGTGCCTAGAA. Internal left primer: ACTCCATATCTCCGCAGGAA. Internal right primer: TCCTGGTCCATCTTCGAGTT. Internal WT amplicon: 2083 bp. Deletion size: 990 bp. Deletion left flank: TGAACACTTTTTTGTAAAAAATTTGGTTGC. Deletion right flank: CACGAGGGGCGTGGCCAACGACAATGATTG. Insertion Sequence: CGAGTTGGAACCAATTGATTTGAGCTTCATTATTTTTGAATATTCTAAATAGTTAAAGG TCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2690 | Y37F4.6(gk1113) I. | Y37F4.6. External left primer: GCGGGACTGTGTTTCAATTT. External right primer: CAGAAGTTTGTGGGTTCGGT. Internal left primer: CTCAGCAAAGGCCAATCTTC. Internal right primer: ACTCCATATCTCCGCAGGAA. Internal WT amplicon: 1919 bp. Deletion size: 882 bp. Deletion left flank: AGCAAACTGAATATTACAAAGCCCGCATTT. Deletion right flank: AAACTTGTTAAACACAATGTGATCTAAAAC. Insertion Sequence: AAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |