Gene Information: sri-14

Namesri-14 View on WormBase
Species C. elegans
SequenceM01G12.1
Genetic positionI:13.06 +/- 0.001 cM
Genomic positionI: 12134268..12136465

Strains carrying this gene

Strain Genotype Description
VC2123 sri-14(ok2865) I. M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807