Gene Information: ent-2

Nameent-2 View on WormBase
Species C. elegans
SequenceK09A9.3
Genetic positionX:22.92 +/- 0.006 cM
Genomic positionX: 15601067..15603686

Strains carrying this gene

Strain Genotype Description
VC1169 ent-2(ok235) X. K09A9.3. Homozygous. External left primer: TTGCCTAGCAGACGTTCCTT. External right primer: TGAGGAAAAATCCAGCCATC. Internal left primer: GCTACCGTCTGACCTACCCA. Internal right primer: CACCTGAGCCTTTGATGGAT. Internal WT amplicon: 3315 bp. Deletion size: 1475 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4121 C36B7.3(gk5200) ent-2(gk5201) X. Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.