Gene Information: F59G1.4
| Name | F59G1.4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F59G1.4 |
| Genetic position | II:-0.86 +/- 0.000 cM |
| Genomic position | II: 5896170..5904594 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3981 | F59G1.4(gk5058[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details. |