Caenorhabditis Genetics Center (CGC)

Gene Information: dod-17

Namedod-17 View on WormBase
Species C. elegans
SequenceK10D11.1
Genetic positionIV:6.83 +/- 0.022 cM
Genomic positionIV: 12976303..12978343

Strains carrying this gene

Strain Genotype Description
PS8540 dod-17(sy1392) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda).
RB1845 dod-17(ok2387) IV. K10D11.1. Homozygous. Outer Left Sequence: GTGCAAAGACCACCGATTTT. Outer Right Sequence: CTTGAGAGCGCCTTTCACTC. Inner Left Sequence: GACAAAACGCCCAGTTTCAT. Inner Right Sequence: CTTTGCTTCTATGTCGGCGT. Inner Primer PCR Length: 2109 bp. Deletion Size: 1489 bp. Deletion left flank: TTCATCTGTCTAGCGTTTGCTACTGCAATT. Deletion right flank: AATCGATGAGATGGTGGAACTCCGGCCGCA. Insertion Sequence: CGATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807