Gene Information: lron-11
| Name | lron-11 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y71F9B.8 |
| Genetic position | I:-7.28 +/- 0.000 cM |
| Genomic position | I: 2735353..2742508 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RB1799 | Y71F9B.8(ok2333) I. | Y71F9B.8. Homozygous. Outer Left Sequence: ACAACCTGATGAGGGGTGAG. Outer Right Sequence: TGCCGGAATTGAAATTCTTC. Inner Left Sequence: TCGTTTGAACAATCGGAACA. Inner Right Sequence: TCCAGACCCTCATCATCTCC. Inner Primer PCR Length: 2841 bp. Deletion Size: 1153 bp. Deletion left flank: TGAAAATCTAGAGTCTTGTAATTGGGACTT. Deletion right flank: ATTTTTTGTAGATCAAACCGTGATGGGACA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC4235 | lron-11(gk5321[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 3394 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCGGCCCTCGGAAGTGTTAGGAGCCTTGGT; Right flanking sequence: TTCTCTAGATATTTTCGGAGAACACCGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |